Review



single-guide (sg)rna pair trueguide synthetic guide rna  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier
Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    Thermo Fisher single-guide (sg)rna pair trueguide synthetic guide rna
    Single Guide (Sg)rna Pair Trueguide Synthetic Guide Rna, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/single-guide+(sg)rna+pair+trueguide+synthetic+guide+rna/synthetic+grna/pmc10545576-25-23-33
    Average 90 stars, based on 1 article reviews
    single-guide (sg)rna pair trueguide synthetic guide rna - by Bioz Stars, 2026-11
    90/100 stars

    Images

    Related Articles

    Generated:

    Article Title: Elevated Adipocyte Membrane Phospholipid Saturation Does Not Compromise Insulin Signaling
    Article Snippet: Human immortalized preadipocyte ADIPOR2-KO line was generated by electroporating ribonucleoproteins containing recombinant Streptococcus pyogenes Cas9 (TrueCut Cas9 Protein v2, A36498, Thermo Fisher) and single-guide (sg)RNA pair (CGAGCCAACAGAAAACCGAT and CAACTGGATGGTACACGAAG, TrueGuide Synthetic guide RNA, Thermo Fisher) targeting exon 1 of the human ADIPOR2 gene, following a recently described protocol ( ).

    Recombinant:

    Article Title: Elevated Adipocyte Membrane Phospholipid Saturation Does Not Compromise Insulin Signaling
    Article Snippet: Human immortalized preadipocyte ADIPOR2-KO line was generated by electroporating ribonucleoproteins containing recombinant Streptococcus pyogenes Cas9 (TrueCut Cas9 Protein v2, A36498, Thermo Fisher) and single-guide (sg)RNA pair (CGAGCCAACAGAAAACCGAT and CAACTGGATGGTACACGAAG, TrueGuide Synthetic guide RNA, Thermo Fisher) targeting exon 1 of the human ADIPOR2 gene, following a recently described protocol ( ).



    Similar Products

    single-guide (sg)rna pair trueguide synthetic guide rna  (Thermo Fisher)
    90
    Thermo Fisher single-guide (sg)rna pair trueguide synthetic guide rna
    Single Guide (Sg)rna Pair Trueguide Synthetic Guide Rna, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/single-guide+(sg)rna+pair+trueguide+synthetic+guide+rna/synthetic+grna/pmc10545576-25-23-33
    Average 90 stars, based on 1 article reviews
    single-guide (sg)rna pair trueguide synthetic guide rna - by Bioz Stars, 2026-11
    90/100 stars
    		  Buy from Supplier

    Image Search Results